The plot thickens...

I am reprinting the comment from one bottom fiend here as it's not showing up down below anymore.

GACGCUAACAUGGCUACCGAG
ACUCAUAUAUCGAUUAGCGCAAAUGAAUGGCACAUCAACACC.......
CCCGAGCGCCACGCUCCCAGU???
GCUGCUGCUCAUGCUCAUGCUCAUGCUCAUGCUCAUUAA!!!!

Now for those of you who are a bit confused this is a message written using the genetic code. Each letter represents a base in a sequence of DNA. DNA usually codes for a protein (a protein being composed of chains of amino acids that fold into very specific shapes based on their sequence) so to make it easier for us scientists each one of the 20 amino acids that could be used to form a protein have been assigned a letter. Each codon of DNA (a codon = 3 bases of DNA) therefore represents an amino acid because that is the minimum length of sequence needed to make sure there are 20 unique codons at least. So in this case, upon translation the first sentence reads:

gacgctaacatggctaccgagactcatatatcgattagcgcaaatgaatggcacatcaacacc
D  A  N  M  A  T  E  T  H  I  S  I  S  A  N  E  W  H  I  N  T

The second and third:

cccgagcgccacgctcccagt
P  E  R  H  A  P  S

gctgctgctcatgctcatgctcatgctcatgctcattaa
A  A  A  H  A  H  A  H  A  H  A  H  *

I suspect there is a typo in the last sentence but hey its still pretty obvious.
There will be a reply. Oh mercy yes there will be a reply.

Once i've recovered from last night.

I'LL NEVER TELL

Yes folks its a little tricky
One of those things you know?
Understanding it took alcohol

And some sleep
Right now i feel kinda stoopid
Especially cause i had it pointed out to me

Amusing though isn't it?

So its out now
Maybe one day they will tell
Apparently I probably did talk to them
Really good acting on their part
Telling me Lies
And now i have to hunt them down and kill them
Rhyming is too much effort
So i'll just write these strange sentences
Expecting them to get the message

:)

WTF?

If its not Monsieur Robson then it must be princess consueila banana-hammock-kiedis-carter-flowers-grohl-jameson-armstrong-depp. Now i see why you english in major and i don't.

(yes that was intentional)

I thought it was a female but then i ran out of female friends CAPABLE OF GIVING ME A DRINK. So then i thought it must be male and Master Robson was the obvious choice due to his penchant for poetry.

If its not princess consueila banana-hammock-kiedis-carter-flowers-grohl-jameson-armstrong-depp then it could be Joe in which case you owe me a drink at tonights 21st

In summing up I want my drink

A conundrum...

Do you have a thing for bottoms Mr. Robson, my oh so poetic stalker?... that took some effort with the rhyming and whatnot. Well done.

if anyone else is confused by the above sentences read the comment in the post below...

meh too tired. will try and be funny tomorrow.

I'm so glad he's been discharged...

I've just been checking out a very old friends site on deviantart.com located here or over to the right in the friends section and have discovered an extremely funny list of things he shouldn't do. Keep in mind that he enlisted in the RAAF (Royal Australian Air Force) as a signals operator. He had one of those jobs where he could tell you what he did but he'd be forced to kill you afterwards. Anyway check out the list and thank god he's no longer responsible for any part of the defence of our country...

Edit: I think i should point out that, knowing Joe, he's not making any of these things up.

I swear my computer is female

Yay! she's talking to me again!

Yes folks the network cable has mysteriously replugged itself and so i have the internet again. I swear this computer is female. It's moody, sometimes completely shutting itself off from me for no reason, about once a month everything goes to hell and i just have to leave it alone for a few days and its always going down on me...

Had an interesting day yesterday, went to uni on about 4 hours sleep, can't remember a whole lot of the day. I was a good boy and had gone to bed at 11 the night before but didn't get to sleep til after 3:30am. Stoopid brain. Anyways my aunt rang at like 7:30 this morning so i'm functioning on 10 hours sleep for the last 2 days. Which means I'm not functioning...in fact...I'm goin back to bed. Good Morning.

Let the feminists come...

Bottom Fiend...

Who are you? do i know you? I'm going to assume i don't and say yay! my first Random Internet User. Thanks to your patronage, traffic on my blog has incresed by 33%. You sir/madam, are a legend!

Tell your friends, neighbours, relatives, enemies, random people in the street, teach your pet to use the computer. Or get one of those rooms full of monkeys with typewriters (connected to the net of course) to write shakespeare to me.

It'd be awesome to get a comment from Toto, Whispy or Rex. I speak fluent Dog and some Cat...

Ruff, Ruff-Ruff, Ruffer?
(Have you seen my T-bone?)

Ruffer, Ruff, Ruffer, Ruff-Ruff?
(Do you have my T-bone?)

Ruffer, Ruffer, Ruff, Ruff-Ruff
(You owe me a new T-bone)

Shameless rip-off i know but i would be bereft of humour without plagiarism...

IBM - I Blame Microsoft

Hah!

I bet you thought I'd given up on on this whole blogging thing but not so.

My computer, from time to time, randomly decides that "a network cable is unplugged." Despite verifying, on several occasions, that the network cable is not, in fact, unplugged my computer insists that it is. Consequently I will have no internet access at home anywhere from a day to several weeks. When it decides to "find" the network cable again I will be able to update at home but for the mo' I'm doing it from uni.

Any of you windows savvy types have any suggestions? In a retarded move by the windows developers all of the possible solutions to my problem provided by the networking trouble shooter seem to involve connecting to the internet at some stage. I say retarded because putting a stage in the "I have lost all internet access" troubleshooting process that involves connecting to the internet seems...I don't know...

REALLY.

FREAKIN'.

RETARDED!

Calm. Cool. Focused...And I'm back...

So yeah no settings were changed (at least not to my knowledge but with windows who can tell?) and yet I turn my computer on one morning and hello! no internet or networking. I've been through and checked all the settings I can find and they all appear to be the same as they are when its working. I am at a loss.

Really that troubleshooting thing shouldn't surprise me Windows has a history of this. This is the company that supplied a product to its customers with a warranty. This warranty was voided if the box was opened. The disclaimer that explained that the warranty was voided if the box was opened was...INSIDE the box. Not surprisingly they got sued and lost.

So yeah...I Blame Microsoft

Before I Forget...

Me and some Uni mates went camping last week on a M*A*S*H* themed weekend. It was good fun and I felt I must share these photos...

Some nice group shots. For anyone viewing this who doesn't know me, well done for finding this (or did you just hit "next blog" i wonder?). I am third from the right in the first one. Can you spot me in the second one?

this is the best photo i have of me dressed up for our M*A*S*H* night. If you look closely you can see my pink fluffy slippers...

Oh btw i was Klinger and yes I am wearing a shower cap and bathrobe.This stunning brunette is Brett. The first two are from his "Woodsman" collection and the last one is...well...it defies all logic. If you have seen Zoolander this was Brett's best shot at Magnum

This final shot is of Brett in every single piece of clothing he brought for the two and a half days. We were camping west of a place called Maleny, which is in the Sunshine Coast Hinterland, and it was bloody cold.

anyways lets see how these pics turn out on the blog shall we?

Mai Dei

yeah today was orright.

i think i'm finally getting over the initial blogging frenzy that i suppose comes with a new toy like this. went to uni, aimed to be there 30 mins early so i could drop some stuff off to a friend but somehow managed to make it in an hour early. snaps for me. had a lecture on various aspects of immunology. broke out into cold sweats at the realisation that at some stage i'm actually going to have to learn this stuff.

came home...well tried to but train was 15mins late and an express for some mysterious reason. had to wait again at central. getting hungry at this point. considered gnawing on own limbs but decided fellow platform occupiers were much tastier. began picking out the old and sick to be consumed first. train came. cannibalism averted...hooray.

got home. ate food. discovered haven't paid tax for five years...boo. turns out i'm over the threshold to pay tax but under the threshold where they actually keep any of it. ATO (Australian Tax Office) hasn't asked for it nor have i been issued any group certificates. much confusion over whether i should tell a bureaucrat about this. decided against this as i'd like to keep the things i own...like my clothes. tho i might ring them from a payphone or something...

attempted some uni work...got distracted. by many things. computer, TV, motes of dust in a beam of sunlight, navel lint, that spot on my ceiling that looks like Elwood Blues.

well til tomorrow kids...

p.s. still haven't recieved any hate mail. is my email up? very miffed...

Messin' Around

Just finished messin round with the side bar. now have 3 categories of links XD.

will post about my day later because it was sooo interesting.

if ya wanna know why i'm doin biotech check out the videos in the "Cool Stuff" section.

They is awesome and they is aimed at high school kids so theres a bit of an explanation with 'em.

I'll be updating these links from time to time so both of you make sure to check back...

No. 9, No. 9, No. 9, No. 9...

hehe Beatles

anyways i just thought of something totally profound

"An eye for an eye will make the whole world blind" thanks Ghandi you were the man

now i really am goin to bed

No. 8, No. 8, No. 8, No. 8...

hehe Simpsons...

anyway just been messin round with the links, added a few friends. I'm not sure the servers they're on will be able to handle all the extra traffic they'll be recieving now but oh well...

sorry bout those last two posts got a little catty there. must be some kind of hormonal thing...too much KFC or something...which is odd cause i can't remember the last time i had KFC...hmmm

this is now the longest i've kept up a diary-like thing in my life...i think. looking at the clock it has now been two days technically speaking. Although in reality its been just over seven hours. either way it's still the longest :)

Medical Biotech II lecture tomorrow. Fun, fun, fun! although it hasn't been all that bad, our lecturer referred to his children as "tissue engineering experiments" last Monday which technically speaking they are...but still... kinda creepin'

anyways i'm goin to bed.

to the other side of the world: don't do anything rash while i'm asleep

Addendum

referring to my previous post are the "gentlemen" at the mighty aryan-nations.org aware that "aryan" refers to the indo-iranian family of languages? It can also be used to refer to these people as a whole. i believe the word aryan came from ancient persian(Persia being modern day Iraq) but i could be wrong. Anyway you can find out at any online dictionary...takes like 30 seconds...

oh...wait i see they're using it in the sense that Hitler used it. well ya see there's a problem...Hitler was insane.
And not particularly bright. he did have his bright moments (look at the VW beetle for instance) but he also attacked Russia opening himself up to war on two fronts, a cardinal mistake in military tactics and he attacked Russia. Russia the country that in centuries of conflict had never been defeated because of a hostile climate and population, that not even Napolean could overcome. And he attacked Russia...

back to my main point...

aryan-nations.org = white supremacists

Aryan ≠ White

that little thingy is a does not equal sign btw

therefore aryan-nations.org loses

for goodness sake guys read a book, or hell even surf the "internet" for a few minutes, they have it on computer now y'know?

actually reading further down their homepage it turns out that they are welcoming Muslims into their ranks now...interesting i seem to remember looking at their page in high school and reading their leader of the time saying they were the scum of the earth along with "the hated jew" so i guess its ok for them to use aryan because now an extremely low percentage of them may in fact be aryan.

well i just feel stupid now what a waste of a rant...

Whie Power or Getting down to Profundities...

Being that my blog has the word profundities in its title some of you may have been led to believe that there would be, not one, but at least two profundities in my blog. Or perhaps even some ISSUES discussed. Not so.

I always just thought that when it was time the profundities would flow in like a king tide. Maybe i'm just not that profound. <- could this be a profundity? it would be ironic no?

In order that i may remedy the distinct lack of profundities so far (its been less than a day since i set this up, profundities take time) i thought i'd share an anecdote of mine that still makes me laugh.

I've told this story to my friends many times and i think it illustrates a very interesting point about racism and those who openly practice this ideology, i just wish i had a camera with me.

Anyway here goes...

On one of my regular train trips up to the sunshine coast, a lovely region about an hour and a half north of brisbane by train, to visit my aunts and grandmother, i saw something funny. As we were nearing a station we passed one of those little cinder block huts that seem to breed near country train stations. It had recently been given a cheery coat of white paint and as so often happens the bored youth, who seem to breed near train stations the world over, had decided that cheery white wasn't their thing. "Graffiti" is the word the kids are using these days. Graffiti had been applied to the hut in an eye catching shade of crimson. The freakin' idiots that had done this had emblazoned the hut in big letters with the words "WHIE POWER" then to add insult to bad spelling these knobholes had tried to add a few swastikas but being of below average intelligence and probably having not taken the time to research had sprayed the swastikas on going both ways. i.e. one swastika had the arms bending to the left the other to the right.

now i doubt that these guys (or gals) were serious but if they were it illustrates the point that in order to irrationally hate someone of another culture, faith, race or whatever you have gotta be dumber than a bag of hammers. If they weren't serious then we can still learn something, don't spray paint while drunk...

if they weren't drunk then there is no hope for the human race...

go here and fear: http://www.aryan-nations.org/

i would laugh at these people only they are real frikkin scary

oh by the way there will be a prize for the first piece of hate mail or hate comment i recieve.

i.e. i will make fun of you in a future post

anyway enough of my high-horsing i'm going to get down now before i get hurt (normally placid animals have a thing for attacking or urinating on me, long story, prolly in another post)

The flood arrives...

yes folks the flood has arrived...

in the form of a friend wetting her pants over the foo fighters

an admirable cause for pant wetting admittedly

if you are getting a little scared right now please consult the comment or hopefully comments, plural, on my first post and all will be revealed.

so there ya go princess...your prize for being the first to comment.

yes thats right she gets her own post, you could have had one too but you were too late, betcha feel left out huh?

huh?

yeah i thought so

Note: You prolly don't have to ask that nicely and i'll do a post concerned with you, whoever you are.

Breaking news!

I have just been handed some small pellets of heaven by my housemate...

Lyss: Try these...

Dan: What are they?

Lyss: Just try one...

Dan: Oh jesus God it burns!

Imagine a dog biscuit constructed of solid dark chocolate, imbued with coffee and cinnamon and coated in chili powder!

pretty awesome. very bad for dogs (chocolate being poisonous to our canine friends dontcha know) but still awesome.

Note: i am convinced she is trying to poison me but if this is how she's going about it keep it up!

Awaiting the Flood...

OK.

So.

Here we have the Blog. That is a pretty sweet blog you might say.

Round!

Ok being that i just put the URL for here up on my msn thingy i thought it might be a good idea to have something to entertain the masses that will surely be beating a path to my blog...any second now...

guys?...

Dynamo is sad :-(

i waited a good minute or two after modifying msn and theres no one here yet *sigh*

it would appear that threatening people with rabid genital consuming squirrel ninjas is not enough!

meh at least it means i don have to come up with anything entertaining...

Finally

That profile set up was a bit of a nighmare. Apparently you can only have a measly 600 characters to list your favorite music. Consequently some culling of my precious, precious music was required.

Why do i get the feeling i'm talking to myself?

meh it happens all the time and it helps me think...

w00t!

The fools! They have given me blogspace, the world is mine!

Muhahaha!!!

Was that too dramatic? I can never tell. So now i have my own blog.

Sweet.

Yeah...

So...

Umm...

Now what..?