Sunday, July 31, 2005

The plot thickens...

I am reprinting the comment from one bottom fiend here as it's not showing up down below anymore.

GACGCUAACAUGGCUACCGAG
ACUCAUAUAUCGAUUAGCGCAAAUGAAUGGCACAUCAACACC.......
CCCGAGCGCCACGCUCCCAGU???
GCUGCUGCUCAUGCUCAUGCUCAUGCUCAUGCUCAUUAA!!!!

Now for those of you who are a bit confused this is a message written using the genetic code. Each letter represents a base in a sequence of DNA. DNA usually codes for a protein (a protein being composed of chains of amino acids that fold into very specific shapes based on their sequence) so to make it easier for us scientists each one of the 20 amino acids that could be used to form a protein have been assigned a letter. Each codon of DNA (a codon = 3 bases of DNA) therefore represents an amino acid because that is the minimum length of sequence needed to make sure there are 20 unique codons at least. So in this case, upon translation the first sentence reads:

gacgctaacatggctaccgagactcatatatcgattagcgcaaatgaatggcacatcaacacc
D A N M A T E T H I S I S A N E W H I N T

The second and third:

cccgagcgccacgctcccagt
P E R H A P S

gctgctgctcatgctcatgctcatgctcatgctcattaa
A A A H A H A H A H A H *

I suspect there is a typo in the last sentence but hey its still pretty obvious.
There will be a reply. Oh mercy yes there will be a reply.

Once i've recovered from last night.

2 Comments:

Anonymous The Bottom Fiend said...

This is getting out of hand,
I'm not the only fiend, understand?
I've only posted in your journal twice,
I have an imposter! This isn't nice!
I'm not a very happy lad or lass,
Find someone of your own that you want to harrass,
Leave Dan and I to our little game,
Don't join in, it's inexcusibly lame,
Or are you playing me like I'm playing you?
Dan, Dan, Dan, you have some explaining to do!

9:13 am  
Blogger EJ said...

I dont think that the last part of the message was a mistake...

AAAHAHAHAHAH*

Looks to me like an evil laugh... perhaps the imposter who wrote this knows the bottom fiend and is trying to give you a MASSIVE hint.

Who do you know that laughs like that?

3:29 pm  

Post a Comment

<< Home