Dynamic Profundities

2011-01-20T22:14:00.000+10:00

2011-01-20T09:51:00.000+10:00

2011-01-18T12:20:00.000+10:00

2010-05-23T12:36:00.007+10:00

2008-09-27T00:14:00.003+10:00

It's been a while...

2007-03-20T00:34:00.000+10:00

So...ummm...hello?

Is this thing on?

Been a while eh?

Sorry, sorry...been busy (why do I get the feeling I'm apologising to myself?)

But now it's 12:20AM and I'm still at Uni, trapped by Brisbanes infernal public transport system which refuses to run after 11:15PM

trying to weigh up whether I should fork out for a taxi...hmmm

It's either that or go and sleep on a friends love sack and no, it isn't what you're thinking...I'm just not that lucky

So I'm now demonstrating at Uni...2hrs of complete mayhem as 3rd year students run around, like the proverbial decapitated poultry, trying to do experiments while I sit back and laugh, pausing only occasionally to help one of the poor unfortunates.

Good Fun

A Poem of Niceness

2007-01-23T22:08:00.000+10:00

Because what else am I gonna do with my time? =/

I write this verse for Luke
A fellow beyond rebuke
He wanted a poem
So now I'll show 'im
This here rhyme aint no fluke

So the rhyming begins with a first
By a poet who's truly well versed
It draws us all in
with content not thin
And leaves us with a poetical thirst

The second begins with a flourish
The readers interest to nourish
It continues the story
Of lyrical glory
And there isn't a partner for flourish

Now to the third plus one
Where we bask in theoretical sun
Dreaming of days
Of sentence and phrase
But still onward the verses must run

Then sadly it comes to an end
The straight must come to a bend
I want my book
And my quiet nook
I hope you enjoy this my friend

Fin.

An Ode to that which gives us life

2007-01-15T23:20:00.000+10:00

A flower in bloom
Giver of coffee'd delight
Lazurite Lotus

A New Years Wish

2007-01-09T22:21:00.000+10:00

You found love this year so I don't really know what else to wish you except to say, may it remain with you.

Tears of Joy
Days of Wonder
The wind in your hair
And a smile in your eyes

Love always

Dan

Don't give up!

2006-11-03T00:29:00.000+10:00

Seriously folks every time you don't check my blog, God kills a kitten =(

So...drunk and in a bloggin' kinda mood.

What's happenin' in my world?

Not a whole lot apart from the fact that, that whole honours thing is still happening...despite my best efforts.

I get to play with breast....cells... ><

No really, they're a breast cancer cell line and they're hard to kill. Soon my babies will be used to take over the world...>.>

Did I just say that out loud?

Type out loud even...

Got a 7 (High Distinction or 85%+) for my Grant proposal....I guess that rocks

Got an oral presentation on Monday...will be interestin' as I have to go 1st out of everyone

Speaking of which if you're bored and are at Gardens Point campus of QUT at 9AM Monday morning come to Q601 and watch meh...

Going to bed...sorry I've been so slack with the bloggin' but been kinda busy =P

Ummm yeah....

2006-10-19T21:50:00.000+10:00

So...have fun...

I feel inspired...

2006-08-01T21:22:00.000+10:00

By a complete lack of motivation!

So doin honours now.

Lotsa reading and not a whole lot of writing going on, which is bad cause I got this grant proposal thing due in 3 weeks or so. New building at KG is pretty awesome but still a whole...big amount...of things wrong with the place. No desk for me, no computers for the students, half the equipment hasn't been installed in the labs yet, half the supplies have been ordered but haven't arrived yet, no negative pressure in the PC2 labs...which is bad, No access to the labs for honours students etc. These things aside everything is running smoothly.

Have to move sometime in the next couple of weeks...Real estate let us know on friday, after we rang them twice, that the lease wasn't being extended. Finishes on the 18th so that should be fun.

Female Kieryn is off trotting the globe for a month...huzzah!

Keep putting off or forgetting tax return which is bad.

Still don know if I'm gonna be put on to Youth Allowance or not...may have to do another fortnightly form so I can, y'know, eat for the next fortnight. Means I'm gonna have to find time in between my 9-10 hours of uni a day to apply for 4 jobs :(

Brain too fried from uni to do anything other than eat and sleep...can't even coherent sentences form.

Who wants to know more about Ghrelin? I'm sure you all do...

It's name comes from the Proto-Indo-European root 'ghre' which means to grow. Its an Orexigen that is found in the stomach lining but is also highly expressed in prostate cancer. It is responsible for triggering a pathway that results in the release of human growth hormone It has a half life in cells of approximately 30 mins. This makes it hard to study the effects of long term exposure on a cell. My project basically involves modifying ghrelin ever so slightly to increase its half life without changing its normal action. Basically I'm creating a research tool that will be used by the research team I'm now a part of to study ghrelin's role in prostate cancer. Which is pretty cool.

Thats all I can remember for now...stay posted for more cause I know you can't get enough...

Boo!

2006-06-28T00:28:00.000+10:00

Heya there...

An update...

Am sick...again. That gives me about 3 days in the last month where I haven't had a cough, a runny nose or mucous running down the back of my throat.

mmmm salty!

That combined with having nothing to do and having to look for a stupid amount of jobs each fortnight is slowly sapping my will to leave the house...if you're reading this send chocolate!..and one of those buxom swedish nurses they're always talking about in the movies. At least then I'll have a good excuse to stay inside...

I think I've made 1 non centrelink/food gathering trip outside our yard in a month...at least thats all I can remember.

In other news...

We were robbed! Stupid ref and his stupid penalty that wasn't a penalty that gave the stupid Italians a stupid easy shot at goal stupid. Good game, shitty way to exit the world cup. And that smarmy little bastard who took a dive to get the penalty, if you watch the replay you can see him smiling and pounding the ground with joy when he's supposed to be down "injured" after such a "vicious tackle". He didn't even get touched and somehow, while being fouled, managed to control the ball around the player that was fouling him...

Anyways...

How is everyone?

Oh yeah enrolled in honours on thursday...which reminds me, I have to ring Centrelink tomorrow and tell them.

I think thats all...gonna go read in bed for a bit

Night!

This may be a little Risque (the e should have a little ` above it)

2006-06-02T20:11:00.000+10:00

Hey all

before you follow the link you may wish to have handy the eye gouger of your choice

I have just discovered the existence of something (a NSFW something) and I thought I'd share it all with you. Apparently there are some really, REALLY desperate people out there...

S0...

Its my birthday in 8 and a half months...

C

2006-06-02T13:04:00.000+10:00

Yes thats right folks its the 100th post!

(The big C is the Roman numeral for 100)

Some interesting facts about the number 100:

100 = 10x10

To add up all the numbers between 1 and 100 you need to do 100/2 then write the answer out twice so

100/2 = 50

5050 is what all the numbers between 1 and 100 add up to (also works for 1 to 1000, 1 to 10000 etc.)

The word Decimate comes from a roman practice of selecting 1 in 10 men in a legion and having their comrades kill them. (not strictly a 100 fact but its 10 and that kinda works)

Anyways I'm sick but good news!

I cut off the sickness beard yesterday, so I'm on the way back.

In an interesting side note I once heard that ancient egyptian physicians wouold shave off the hair on their patients when they began to treat them. When the treatment came to an end they would shave them again, weigh the hair and based on that determine their fee...

Until next time...

Obey your Master!

2006-05-27T11:41:00.000+10:00

Hey all...

Several things.

1. It was my last day of work yesterday. Very sad as I like the people and the money. Very happy as I no longer have to worry about work.

I got one of these as a going away present...

Unfortunately they only come in XL so its a little bit big. Still the best leaving work present EVER! Though I'm not sure the rest of my colleagues knew what was happening. I got home and put it on then I ended up wearing it to bed because...

I'm SICK!

yes I'm sick which meant I spent last night huddled into a ball shivering incessantly under about 6 layers of clothing and bedding. It also meant no post work celebration, no cocktails tonight and probably not a whole lot of cleaning this weekend which is bad because I need to cleanup my stuff from around some of the girls' furniture.

2. ...

3. ...

Damn

I did have other things but my brain has ceased to function. I'm getting new housemates. 3 guys so the Wilstonhouse is gonna be turned into a stinky boys dungeon :(

Well thats all...I'll try and do something spectacular for my 100th post.

Its an Arockalypse!

2006-05-25T09:08:00.000+10:00

I dunno if you people follow this sort of thing but I felt it was necessary to point out this years winner of the Eurovision song contest.

Lordi

Lordi are teh Rock!

Five dudes from arctic Lappland in full body latex costumes...truly awesome

The fact they beat out a bevvy of beautiful european ladies belting out wannabe "R&B" pap thereby crushing their pathetic dreams beneath a 3 inch heeled lace-up boot? Sensational

Here is where you can have a listen to the song they won with...its actually pretty catchy

Now all I have to do is figure out how to get a hold of their albumn...

A Mystery...

2006-05-07T00:16:00.000+10:00

I was sent this over the venerable MSN messenger, the Sendee shall remain nameless...unless they happen to be a contact of yours...

Funeral Raid!! says:
I saw titties!
Funeral Raid!! says:
They were exposed
Funeral Raid!! says:
I seen them
Funeral Raid!! says:
up close
Funeral Raid!! says:
Lucas' pawpaw ointment

Now I understand everything up to that last point...

Titties were seen. Up Close.

All good so far...

Lucas' Pawpaw ointment?

o_O WTF?

Ok had to google it to make any sense of it and this is what i got...

Cool

So from what I understand Titties were seen. Up Close. Then ointment was applied...how romantic and sensual. Good work :)

Something else big happened...

2006-04-21T18:30:00.000+10:00

I just can't for the life of me remember what it was...

Lets see...

I still don't have a girlfriend...check

On a side note still suffering the Hawking Libido Dilation Effect...cause you all needed to know that...and I thought it was funny

All my relatives remain unmaimed and alive...check

I still have all my organs...check

I still can't play Stairway...check

I still haven't cleaned my room...check

hmmm...

I'm still an undergraduate...che...wait a minute! Thats right!

I graduated the other night. It was boring and hot but there was cheesecake and beer so the night evened out pretty well.

Here are some pics:

Can't see me?

There I am! :)

Mor Mor (Thats Mother's Mother to you non Swedish speaking Philistines...)

Me from the front...

Me from the back...sort of

Me and Kieryn

Goddamn! I am a sexy Bitch! That smoldering gaze, those noble features.
...Kieryn looks alright too.

I appear to be happy about something...

These are the only photos I have in digital format so far. I'll post more if I get them.

drool

2006-04-20T22:13:00.000+10:00

Hey all,

long time no post.

I'd apologise for not posting earlier but I've been earning teh cash and haven't had time...to apologise.

So first Update.

Zardoz.

What can I say?

This movie is truly awesome. Full of stunning social and philosophical commentary and quite possibly Sean Connery's most moving and mature performance to date. The visuals were truly excellent with a superb costuming effort backed up by sets that are still fresh to the modern eye. The special effects and cinematography were light years ahead of their time and still continue to impress.

In summing up a masterpiece of modern cinema.

Thanks for the best birthday present I've had in a long time Trish.

Remember, Remember the 5th of November...

2006-04-02T13:16:00.000+10:00

Firstly...

Whats that song called thats in the...I think it's an ad for razors...it might be called push it possibly by vanilla ice? Or is it Salt 'n' Pepa?

y'know with the do-do-do-do-do-do do-dodododo-do bit? (I do realise this will translate badly in your head and I apologise)

Secondly

Jeebus...

I forgot.

Anyways went and saw V for Vendetta last night and it was pretty kick arse. I thought ...gah! Accursed housemates with your stinking incense!

Why?

*gag*

Why?

Vision...fading...not much...time...Must...finish bloooggggg.... *drop to the floor twitching spasmodically*

Anyways where was I?

Oh yes Hugo Weaving. I think he did exceptionally well considering the only things he had to work with for the entire movie were his voice and the tilt of his head. The story had some strong messages in it which I think you would have had to have been dumber than a bag of hammers to miss or maybe if you're from Texas. (I apologise to all the kind, considerate, intelligent and well educated Texans out there, once again your noble state has taken one on the chin for the sake of comedy)

Although I was saddened to hear that the guy who wrote the original graphic novel series, Alan Moore, had become disillusioned with the way hollywood treated his works after their adaptations of From Hell, Constantine and League of Extraordinary Gentleman and was refusing to be paid or have his name associated with V for Vendetta.

So apparently the themes of the comics revolved around anarchy vs. fascism and mad antihero vs. sane hero. When you see the movie you can observe that the theme is very muchly Good vs. Evil and Democracy vs. Terrorism. Its enough of a twist to be a little irritating and over the top.

Anyways have a good one

An Update

2006-03-29T17:46:00.000+10:00

There still is a man named Dan
Who writes limericks whenever he can
He did this one up
Just to shout out wassup?
And all went according to plan

ok I'm sorry that was pretty lame.

So Lappie is back, TV tuner and Gigantor the Remote included. Still a little teething trouble with the channels but I'll sort it out.

On another note goin Amp shopping at some stage. Thinking about one of these babys but we'll see.

Now I must re-bond with lappie...

About a man named Les Paul

2006-03-19T20:44:00.000+10:00

hey all,

not much to report. Work is long and boring...kind of like uni used to be. I end the day by attempting to recap what I did for the day...and fail.

had a housewarming for the 2 girls that have moved in, at their suggestion. I was the only one that invited anybody...again.

Bright Notes:

Have first important meeting tomorrow. Meeting with people from all the institutes associated with QUT to discuss...stuff.

Got to play one of these on the weekend. Like a deer in the headlights of rock I froze...

If it was a lady I'd take her home and climb her like a redwood...

Thats about it actually...hmm I apologise for not being my usual witty self but...meh.

sigh

2006-03-08T02:18:00.000+10:00

Well its now 2:15 and I'm still awake. Just had to get up to get some bread to munch on as hunger was keeping me awake. Whats everybody doing at the moment? Sleeping I imagine.

Bastards...

Can't Sleep...

2006-03-08T00:30:00.000+10:00

I say Goddamn!

Its hot...

Really hot...

Here's a quote for you Trish...

"Ezekiel 25:17, The path of the righteous man is beset on all sides by the inequities of the selfish and the tyranny of evil men. Blessed is he who, in the name of charity and good will shepherds the weak through the valley of darkness. For he is truly his brothers keeper and the finder of lost children. And I will strike down upon thee with great vengeance and furious anger those who attempt to poison and destroy my brothers and you will know my name is the Lord when I lay my vengeance upon you"

Not bad for 12:45 at night from memory

Whats Interesting is that you won't find this passage in any Bible here is the real Ezekial 25:17 as laid out in the King James Version...

25:17 And I will execute great vengeance upon them with furious rebukes; and they shall know that I [am] the LORD, when I shall lay my vengeance upon them.

Seem pretty simlar? Well it is but none of the rest of Samuel L.'s speech appears before it. I've always been curious about where Tarantino got that speech from.

3rd time lucky...

2006-03-03T08:43:00.000+10:00

yes folks this is the third time I've tried to catch up my blog and more stuff has happened in the meantime so this is going to be a long post. (Trish this might be a good one for the lunch break, hell ya never know it might spawn a real headache ;) )

Please read on faithful..reader

Where to start, where to start? I suppose I should start with honours as thats where I was last time I posted...

At a final count of 81 pages it is officially the biggest assignment I have ever done on my own being beaten only by the business and biotech assignment I did with 3 straight 7's people which was 94 pages. For about a week there I compiled my little heart out, in the process I read somewhere in the vicinity of 130 patents, now for those of you who have never read a patent I'll include a small section from the description of one of the patents from my honours project:

Under such situation, the present inventors have made intensive studies to be from the shortcomings of the conventional surface display methods, and as a result, we have developed novel display system eliminating the need of motif for surface display.

Surprisingly, it has been found that the developed system is capable of displaying any protein on surface with maintaining inherent structure thereof and when displaying in excess, a genetic carrier maintains its viability and resistance to surrounding environment.

Accordingly, it is an object of this invention to provide a method for preparing a protein of interest surface-displayed on genetic carrier.

It is another object of this invention to provide a method for improving a protein of interest by using the method for surface display on genetic carrier.

Now I've used a fairly extreme example here, it was written by a korean whose grasp of english wasn't so crash hot but even so this produced only slightly more confusion than normal. Basically what they're trying to say is we have an invention and this is what it can be used for. Thrilling stuff. Being a patent attorney is an art, they're deadly specific about the smallest detail while at the same time being as broad and vague as possible to cover as much as possible.

Anyways back to the project...where was I?

Oh yes... approximately 130 patents, 48 companies (later reduced to 46), approximately 50 technologies reviewed and around 300 products reviewed. Additionally I drank 14 cans of V, ate 2.5 kilos of chocolate and had about 35 hours of sleep over the week leading up to the due date. Of those 81 pages only about 10 were actually written by me, the rest was raw data about all of the above things (aside from the V and Chocolate).

I was supposed to be analysing these technologies and companies, comparing them to a technology I was given and then making a recommendation about what should be done in terms of a licensing deal or perhaps a spin-off company. I was a bit apprehensive towards the end there cause I'd started to realise that there wasn't anything too special about the invention and I was beginning to think that my conclusion would be to not invest in the technology. I went and talked to Samantha, my supervisor, and told her what I thought and she said "Oh thats good, thats what the VC's have been telling us..." w00t! I came to the same conclusion as the professionals! This made me very happy :) Need less to say once I knew I was on the right track everything flowed pretty smoothly from there and I managed to have everything finished for hand in by 10:30 friday Morning...that, incidentally, is the earliest I've ever had an assignment done in my life. Glad I got the hang of it.

In other news it was my birthday on the 16th which was a Thursday. Guess what was due the next day? Guess who forgot their own birthday? Guess what I did all day? Yeah not the most amount of fun but still not the worst birthday I've ever had...that would be my 21st.

By the way thanks Kez! The dinner and movie was just what I needed and your timing was impeccable and the balloon was cool even when it escaped :) I really appreciated the effort, not sure if I conveyed that at the time...

In other news my science based honours will now be delayed until July because I found out on the Wednesday before the honours I've just completed was due that I was supposed to be enrolled in science honours in January and all the WH&S talks and induction stuff was happening in the week when my other honours was due so that kind of screwed it. Meh its ok it means I get a break, I get time to earn some money and I'll miss the kafuffle with the move from Gardens Point to IHBI. Although I am a bit worried that Dr Jon, my supervisor didn't say a word to me about grant proposals, enrollment or induction or anything...

That weekend went and did a day with Trish finishing up some stuff for Monday. Good Times.

The following week took it easy. Sat. Ate. Good Times.

Oh wait went out "for a drink after work" at 3pm with Trish and Jon Robson, got wasted, fell down. Good times.
The next day we met up again and headed over to southbank. Saw Hostel, fairly average movie that had been hyped because of it's extreme violence. Turns out there are like 4 scenes totalling 5 maybe 10 mins of the movie. After that the violence just becomes ridiculous and stupid and not because its not high impact just because it was pointless and stoopid. The Queensland art gallery was much better and I even got a cool photo that Trish took out of it.

Good times.

that weekend it was Alice's 21st so Hartelijk gefeliciteerd! (God I hope thats the right one, there were like 8 to choose from)
The Monday after that I emailed the people I was buying my laptop off of to find out what was happening with it and they replied saying it would ship that day but that there was a world-wide shortage of the burner I had asked for so I would get a $60 refund. Bummer but meh its so close I care not.

Oh joy of joys! Its Tuesday and its here! I can go pick it up from my local post office this afternoon.

Bastard arsehat fucktarded Australia Post! They stole it leaving me with nothing but my genuine leather hard edged case :(
gonna have to wait for tomorrow :(

Managed to get the box home but the unveiling will have to wait until after the movie when I can have a camera present.

Walk the Line was excellent but not as excellent as my lappie. It is a sexy, sexy bitch :)

In the meantime I have 4 days work a week, permanent part time. That will last me until June so hooray! One downside tho is that my Centrelink has been cancelled. It's kinda wierd, I've been on welfare all of my life and now I don't have it I'm feeling a little insecure, once the $1000 paychecks from QUT start rolling in I should get over it pretty quick tho :)

I think thats everything...did I mention my Laptop was sexy? Feel free to contact me for a viewing and photos will follow shortly.

p.s. I'll be fixing the link in the previous post after I post this

Edit: At least I would if NBC hadn't slapped that site with a cease and desist... Found it somewhere else hope it stays up.

Holy jeebus that made me laugh...

2006-02-14T14:48:00.000+10:00

Go here.

Word...

Getting bored with honours...

2006-02-12T14:52:00.000+10:00

So here's another personality test :)

Main Type	Overall Self

Take Free Enneagram Personality Test

Enneagram Test Results

Type 1	Perfectionism	\|\|\|\|\|\|\|\|\|\|\|\|\|\|	51%
Type 2	Helpfulness	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|	65%
Type 3	Image Focus	\|\|\|\|\|\|\|\|\|\|\|\|	49%
Type 4	Hypersensitivity	\|\|\|\|\|\|\|\|\|\|\|\|\|\|	57%
Type 5	Detachment	\|\|\|\|\|\|\|\|\|\|\|\|	49%
Type 6	Anxiety	\|\|\|\|\|\|\|\|\|\|\|\|\|\|	59%
Type 7	Adventurousness	\|\|\|\|\|\|\|\|\|\|\|\|\|\|	52%
Type 8	Aggressiveness	\|\|\|\|\|\|\|\|\|\|	38%
Type 9	Calmness	\|\|\|\|\|\|\|\|\|\|\|\|\|\|	59%

Your main type is 2
Your variant is social

Take Free Enneagram Personality Test

just a quick distraction from my honours...

2006-02-09T09:08:00.000+10:00

Firstly this.

All hail the The Flying Spaghetti Monster!

I wanna be a Pastafarian and celebrate Ramendan too!

Ahem...

Honours is up to 50 pages of raw information. I think I've read somewhere between 70 and 80 patents up to this point and trawled through about 35 company websites looking for information on their technology and products. Only four more companies to go :) then its on to some actual analysis...

All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy, All work and no play makes Dan a dull boy...

Edit: Oh dude sweet! The holy men of the FSM are Pirates!

Holy Crap! Its Genius!

2006-01-27T10:14:00.000+10:00

Go here and marvel at the ingenuity of the Australian male.

Why didn't I think of it? In case eBAY yanks it. It's four mates in Sydney selling a weekend with themselves. Basically they provide the beer the snags and the good times and you provide yourself and the moolah which at 10:18 this morning is up to $2,425.

Bastards...

The most exciting thing happened recently...

2006-01-25T11:23:00.000+10:00

I bought new strings for my guitar!

For those of you who don't know I haven't changed the strings on my lecky (electric) since I bought it about 4 years ago. For those non musos among you, you're supposed to change them about every 2 months depending on how much you play.

Whats even better is that the shop I bought them from was having a 2 for 1 sale so that means, as Master Robson pointed out, I have an entire decades worth of strings. Yay! :)

Oh and I bought new shoes also. No more big toe sticking out of holes in soles! I can now walk over broken glass and gravel without a care in the world and, as an added bonus, I no longer have to worry about rain or puddles, acid or otherwise. Hooray!

On second thought that wasn't really exciting was it? I'm really the only one that cares.

Kez was excited about the shoes though...

Meh

Dan out...

Aren't these things supposed to be about me?

2006-01-18T20:47:00.000+10:00

greetings my loyal readers

I just remembered these things are supposed to be about me and whats happening in my life so here goes an update...

Still working altho not for much longer I think as honours will start in another 5 weeks or so.

Honours starts in another 5 weeks...

Unbearbly lonely. A great, black maw of loneliness slowly consuming me. I need to love again but am too emotionally stunted and abused to do so...

Well...that was...morose.

I'm currently stressed to the eyebalss as I have a sense of impending doom descending from on high, sent by the honours I am currently doing...

I don't see as much of my friends (thats you guys) as I'd like even when I try and organise something I don't get a reply or no-ones interested. I'm hoping I'm just unlucky and its not due to my offensive body odour or something...

I'm going to bed before some 14 year old with black, greasy, dyed hair in a Slipknot t-shirt kills themself over this post

This is Kremit Lupin the Wizardfrog speaking here....

2006-01-13T19:48:00.000+10:00

Hey

Just did this quiz

You are Kermit the Frog.
You are reliable, responsible and caring. And you
have a habit of waving your arms about
maniacally.

FAVORITE EXPRESSIONS:
"Hi ho!" "Yaaay!" and
"Sheesh!"
FAVORITE MOVIE:
"How Green Was My Mother"

LAST BOOK READ:
"Surfin' the Webfoot: A Frog's Guide to the
Internet"

HOBBIES:
Sitting in the swamp playing banjo.

QUOTE:
"Hmm, my banjo is wet."

What Muppet are you?
brought to you by Quizilla

yes I did deliberately make it Kremit in the title

I think the quiz could be a mite more comprehensive tho...

Still I'm happy with the result, though I think I like animal better.

What Muppet are you?

Also did this quiz to find out what Harry Potter character I was

You scored as Remus Lupin. You are a wise and caring wizard and a good, loyal friend to boot. However sometimes in an effort to be liked by others you can let things slide by, which ordinarily you would protest about.

Remus Lupin

90%

Ginny Weasley

85%

Albus Dumbledore

80%

Harry Potter

80%

Ron Weasley

75%

Hermione Granger

70%

Sirius Black

65%

Draco Malfoy

60%

Severus Snape

55%

Lord Voldemort

20%

Your Harry Potter Alter Ego Is...?
created with QuizFarm.com

Came out with Lupin so not bad...

Although Ginny Weasley was 5% off and that could have been embarrassing

I'm such a geek...

First post for the new year...

2006-01-05T20:27:00.000+10:00

Upon looking over my blog I have realised that since I started it I have made exactly 80 posts not counting this one.

Hooray!

How is everyone? All is well I trust?

I'm doing super. I am slightly closer to going to Sweden at the end of my honours this year so thats cool.

Here are some people who seem to genuinely believe that finding a living pterosaur will disprove evolution. Do they not realise that all it proves is that the pterosaur did not in fact die out millions of years ago? I especially love their explanation of the Second Law of Dynamics and how they try to use that to disprove evolution. Yes things tend towards disorder and yet, if left to themselves, many proteins dissolved in water will rearrange themselves into functional shapes. i.e. the protein has become more ordered. This is allowed to happen under the rules of thermodynamics because the water around the protein becomes more disordered. Therefore the entropy, or total amount of "disorderedness" in the universe has not changed.

Additionally you are allowed to "reverse" entropy by putting energy into the system...like when you smelt iron ore to produce pure iron. You pump in a lot of energy to turn ore into pure iron. Here, again, the increase in "orderedness" of the iron atoms in the ore is compensated for by the "disorderedness" produced by the various gases evolved from the ore during the smelting process and from the production of the energy in the first place, whether from burning of wood or fossil fuels or from nuclear decay.

So life, while extremely ordered, also relies on energy input i.e. food to remain in that state. So take away food and you lose the ability to repair damage and keep things in their ordered state and you slowly become more disordered and die.

There I suck at physics and yet I can explain it to you...

I won't go ino how wrong their statement about how random mutations cannot add more information to our genome is. It just shows their complete ignorance of the subject. (Yes I do realise that a lot of our genetic information is the result of invasion by retroviruses but still mutation plays an important role, to say that the mutations are random is also untrue. There are areas of the genome that are more prone to mutation than others and the mutations lead to order over time due to selective pressure)

Well that wasn't supposed to be quite so rantish...oh well

til next time...

Merry NDHP

2005-12-24T21:46:00.000+10:00

Merry Non-Denominational Holiday Period everyone!

Unless something extraordinary happens, like...I hook up with Megan Gale on New Years, this should be my last post for the year.

Thanks for everything everyone.

I hate to admit it but I'd die without your conversation, company and ability to keep me from slipping further into the pit of madness our times and circumstances seem to be encouraging the rest of humankind to dip its toe in from time to time :)

Good Luck and Good Night...

Honours Update

2005-12-14T08:08:00.000+10:00

Found out yesterday that my honours with Dr. Jon is going ahead as planned...Yay!

Turns out my marks have improved enough that he knows I'm taking it seriously so he's happy to let me in the lab. All thats left now is for my marks for the last four subjects that comprise honours in my current degree to come in and for me to sit down with the other staff and students I'll be working with and make sure we all get along.

I'll be based at IHBI (pronounced Libby without the L) which will be cool. Brand spanking new research institute to play with :)

My project will involve modifying a protein called Ghrelin so that it has a longer shelf life when stored and a longer half life in vivo.

In other honours news the honours project I had lined up for this degree has begun. I finally got my NDA signed and handed in and my supervisor has begun to feed me the information I need to start. This includes a 60 page patent and a couple of presentations given to various boards and VC's to start with.

So thats all thats happened to me so far. Things are finally starting to take off :)

'til next time...

A New Story

2005-12-11T09:27:00.000+10:00

Here's an update...

I've been working like a dog doing about 35hrs over 4 days a week for the last 2 weeks at the OCS. Took a day off here and there to you know, pay rent, shift my crap from my old room to my new room that sort of stuff. Spent 2 days last week going over some entries done by another person. Around about 75 entries and not one of them was right. I don't even know the guy and I wanted to punch him in the face.

To the 3 drunk guys outside my window who kept me awake until 2 in the morning on Thursday night,

Get Stuffed

Sincerely,

Dan

QUT gets a bit funny with their pay schedule during the holidays but they very kindly sent eveyone an e-mail on Friday the 25th of November telling everyone that the cutoff for handing in your timesheets for the week ending November the 25th was November the 24th. Now be aware that QUT pays fortnightly. I was hoping to be paid on the 30th, a Wednesday but this e-mail stated that cutoff for payment on the 21st of December was the 24th of November. Now I have several problems with this.

1. The date between lodging your time sheet and actually being paid is a month. Normally you lodge on friday and are paid the next Wednesday that is a pay day, whether that is 5 days later or 12. I just have this question... WTF mate? What happens to all those people that don't get paid one fortnight? Surely there can't be that huge an influx of payslips and an eflux of staff that they can't process pay normally. Maybe I'm missing something. Anyone care to give me a reason?

2. I'm baffled by the fact they expect you to predict your hours. Why make your cut off on a Thursday when all the time sheets expect you to give hours for the week ending on a Friday? What? you claim that day on the next time sheet which means you don't get paid for that day until a fortnight after the 21st of december? That's the 4th of January. That means you get paid for work done on the 25th of November on the 4th of January. Thats messed up. Alternatively you make up some hours for Friday which means when you sign the time sheet you run the risk of being fired for defrauding QUT. Thats messed up.

3. They told us the day after the timesheets were supposedly due that they were due. As it turned out I couldn't hand my sheet in on friday anyway because there were none of the 3 people that could have signed off on it in at 3pm. So I rang the pay office and they told me if I got it handed in by 3pm Monday I'd still be paid by the 21st of December.

So we'll have to wait and see...

In other news...

Me and Alice broke up, nuff said. Lyss comes back tomorrow. Yay! I start my honours project tomorrow. Yay!

Honours should be fun...I love reading 60 page patents. On the bright side the technology is cool. Sweet, sweet affinity maturation...

Oh and these are my marks:
LSB619 Genomics and Bioinformatics 85% 7
LSB609 Medical Biotechnology II 75% 6
LSB677 Plant Biotechnology II 66% 5
BSB311 Research, Development and Commercialisation Strategies 73% 5 (curses!)

And prolly the best of all is that it looks like I can still do honours. If I get straight 6's (thats a distinction or 75-84%) for the four subjects that comprise honours then my GPA rises to 5 (a credit or 65-74%) or just above and I get 2B honours. Straight 6's should not be hard for these honours subjects.

Well I think thats everything. Merry Christmas and good luck everyone...

Today I bathed a fish...

2005-12-01T18:46:00.000+10:00

Yes you read correctly. I bathed a fish. I gave my little finned bru a bath...choice.

I wasn't aware you could bathe a fish but, there you go, the things you learn. All it takes is a cup, some tap water and this stuff called "Neutraliser" and hey presto! a fish bath

Also the Library was closed at uni for most of the day today due to a chlorine spill. Nice.

Jon and anybody else who's curious can go here to find out more about YSA and last but not least I have put up a link to cool flash christmas card over in the cool stuff section, you can also find it here

I am the Trivia Queen!

2005-11-27T18:59:00.000+10:00

...I mean King. Definitely King.

Yep trivia night on Saturday. Kicked arse. Won $50 worth of confectionary.

The night had been set up as a bit of a fundraiser for YSA. It was about 5 tables worth of people present and was well worth it for $5...if you won. The table I was on consisted of 9 people who had all graduated/were graduating from either Maths/Physics courses or Biological Sciences courses. The other 4 tables had 4-6 15-17 year olds. Now you may be thinking that this was a little unfair but we were only ahead by four points after 10 rounds of 10 questions each so they did pretty well. Still $50 worth of discount confectionary is a hell of a lot of confectionary even between 9 people. I got a hell of a lot of lollypops if anyone can be bothered to come round and collect one.

In other news I lost my wallet only to have it returned, intact, a half hour later and my room flooded in the rain we had today...

Most Ridiculous Band Ever...

2005-11-25T22:49:00.000+10:00

Ok now here's something everyone can get involved in

Here's my pick for the most ridiculous band ever...

Kenny G - check it out he's got a greatest hits of his 3 previous christmas albumns!
Snoop Dogg
Nick Lachey
Russell Crowe
Dani from Cradle of Filth
Lars Ulrich

Peace

Ummm...

2005-11-25T22:41:00.000+10:00

Yeah I put Tom Araya in on drums cause...I...was...waiting to see if y'all were awake

<_<

>_>

yeah thats it...awake...

anyways the post has been modified to say Dave Lombardo like I originally meant...

(Altho I would like to see Tom playing the drums...with his hands...)

p.s. for those of you who don't know, Tom Araya is a bass player

Rock Orchestra et Supervolkenbanden

2005-11-25T18:41:00.000+10:00

Ok so's I get this out of the way I'm gonna do these together that way we can move on to the more important inanities (is that even a word?) of my life...

Firstly Super Happy Rock Orchestra...

1st Guitars
Jimmy Page
Brian May
Eric Clapton
Tom Morello
Dave Gilmour

2nd Guitars
James Hetfield
John Frusciante
Billie Joe
Chad Taylor
Adam Jones

1st Basses
Flea
Tim Commerford
Robert Trujillo
John Paul Jones
Les Claypool
Lemmy

Percussion
Danny Carey
Mitch Mitchell
Dave Lombardo
Jason Finn

I am a sick, sick man...

Damn its great...

Ok now we have a band capable of starting a demolition company. The first person to tell me what bands all the members of my orchestra belong to gets...something...

I'll think of something...

Now keep in mind I'm still missing a few people (I had 8 people in the 1st guitars section until I realised how sick that was) and also I haven't heard enough music to nearly cover all the people that probably should be in here but these are all people whose playing gets me going.

Supervolkenbanden

The Rules are...

1 Guitar
At least 3 stringed instruments
2 of which must be strummable
Percussion of some description
A woodwind or brass instrument
NO distortion

My line up consists of...

Kyle Gass
Willie Nelson - 200 albumns! Holy Jesus...'nuff said...
Steve Twigger
Samantha Hunt
Patrick Murphy
Peter Purvis
Stephen Wehmeyer
Kunda Drame

Now if you can tell me what instruments all of these people play...and lets face it I didn't try too hard...then you are smart and stuff. The first 2 should be real easy after that it gets a bit trickier. I'll tell you this tho the first 2 are the only guitarists. There's a mandolin, a piper, a Bodhran and some spoons. The last one might be a bit trickier...

Anyways I'm spent, so good luck and I encourage submissions of your own orchestras and Supervolkenbandengruppen (there are currently several million germans spinning in their graves at my bastardization of their language)

Please bear with me I'm in a rambling mood tonight...

2005-11-24T20:01:00.000+10:00

First up after reading my previous post I just have one question...

Did I mention Hendrix enough?

No?

Oh...

Well then...

Allow me to continue...

Not only did he play those instruments I already mentioned but he also played the Bass. Y'kow that cool walking bass-line in 'Hey Joe'? (of course you do) He wrote that. And did you also know that he played the Guitar.

No way!!!

I know, it blew me away the first time I heard that too...

Anyways Hendrix wasn't all He's cracked up to be...his flute playing was shithouse.

But I digress...

Upon reviewing my lineup some of you may have noticed that I have gone for a very technical group. This may have led you to ask several questions. Can they play together? Can they write a song together? Can they write a song anyone would actually listen to? Well I don't know but if I knew there was an albumn coming out with these four playing together on it I'd buy it...wouldn't you?

Other questions you might ask are Where's the style? Where's the flair? Where's the heart, the soul, the blood, sweat and tears necessary for great music?

Well...

If you haven't heard RATM, you don't know about angry music, angry music thats not just Thrash 'n' Grunt: 'Now in new wildberry flavour...' I'm sorry but 'Thrash 'n' Grunt' sounds like some kind of perverted Hi-fibre eXXXtreme breakfast cereal.

'Thrash 'n' Grunt: So high in fibre it forms a gelatinous cube in your bowel...'

'You'll be Thrashing and Grunting for mercy.'

Well...that was graphic...

I apologise for that

Where was I?

Ah yes...emotion. I just have this to say. James? 'Fade to Black' and 'Nothing Else Matters' anyone? 'Nuff said. Flea well he's the part of the Chillis that you feel rumbling through your chest at their concerts, he literally makes the earth move for you. Danny, his drumming is just as emotive as Maynards singing when he plays for TOOL, its almost like he creates his own counter melodies to the vocals sometimes.

I don't think there will be any shortness on flair, creativity or emotion in the music these guys would write...

Is that the clamouring of disgruntled fans I hear? Your favourite player not in my line up? Well...make your own, show me how its done...

And yes I do realise I am alienating the vast majority of my readers with these posts. Hopefully I will have it out of my system soon and things will return to normal

Too much rock for just one hand...\mm/

2005-11-23T22:36:00.000+10:00

Yep can't sleep so heres whats keeping me awake...

Its HAPPY FUN SUPA-GROUPA TIME!

The Criteria are there needs to be at least four members to your group:

1. A Drummer. Where would we be without drummers?
2. A Bass player, not a bass player (i.e. one who strums a fish)
3. A Rythmn guitarist
4. A Lead guitarist

You may add a pure vocalist to make a fifth member of the band otherwise one of the above must sing.

Keyboards, Accordians, Flutes (sorry Kieryn), Kazoos and other blasphemous rock instruments need not apply.

Yes thats right blasphemous.

Altho Hendrix did play a Kazoo in a song once, and a Flute too incidentally. And Keyboards too. Dammit. Ok definitely no Accordians.

Altho if I were to allow instruments played by Hendrix I would have to allow the Glockenspiel as well!

ALL members of the band MUST be alive. No you may not take Hendrix, Elvis (yes Elvis counts as a guitarist, no you may not have him, even if he is living in a cave in New Mexico with his many beautiful Alien wives) John Bonham or Keith Richards (I know he appears to be alive but seriously, have you seen the man up close?)

Following these Criteria I have selected:

1. Tom Morello - Rage Against The Machine, Audioslave, The Nightwatchman - Lead Guitar/Vocals (yes he can sing, The Nightwatchman is his pseudonym when he appears solo and...acoustic!)

Dat dere is one powaful riffer. Combine this with some mindboggling effects laden lead work, blues, jazz and rock chops and the ability to shred should the need arise... I have my candidate for Lead Guitar

2. James Hetfield - Metallica - Rythmn Guitar/Vocals

The Riffmeister himself. Responsible for such classics as "Master of Puppets" "Battery" and the ubiquitous "Enter Sandman". His Blinding speed mixed with some tight 'in the pocket' rythmn work along with his use of some excellent arpeggios makes him my choice for Rythmn Guitar...Did I mention he can solo?

His "I've been drinking tobacco smoke dissolved in bourbon since I was four" voice also makes him my choice for vocals. If you doubt me check him doing his vocal warmups before the concert on the S&M DVD...he's hamming it up but the dude can sing!

3. Flea - Red Hot Chilli Peppers - Bass/Stuffed Toy Pants Dancing (Check out the "Higher Ground" Video to see what I mean)

Well with his 'slap' bass skills as well has his speed and dexterity for normal rumblin' this man gets the nod to keep everyone groovin'. He doesn't seem to showcase it much on the RHCP albumns I have but when you see him in things like the 'Axis of Justice' DVD he can go nuts at will and improv like there's no tomorrow.

On top of all this he has cool pants and is the voice of 'Donny' in 'The Wild Thornberrys'

4. Danny Carey - TOOL - Drums

Lastly the drummer. With Danny what can I say? The man can play a separate rythmn on a different piece of equipment with all four limbs at the same time. He also plays the tabla and has a synth tabla that he hooks up to his drum kit. His extremely complex rythms would be a hard act to follow to begin with but the fact that they are not just for show and actually fit with the song make him a God (something that I think made Hendrix a God also was his ability to fit the very flowery and complex into a song.)

Feel free to submit your ideas on your super group. (Brett how in gods name are you gonna pick who leads out of Richie Sambora and Eric Clapton?)

Coming over the next few days...

Rock Orchestra, a 16 piece (at least) monstrosity featuring all the people I wanted to include but couldn't.

Then...

Supervolkenbanden. Thats right, grab your partner and docee(y?)-doh its folkin' time. The worlds greatest band...unplugged.

Things that have happened to me lately

2005-11-16T19:54:00.000+10:00

1. Bomb scare on trains and buses in Brisbane.

Yes some cockwalrus called in a bomb threat. Consequently all buses and trains in the greater Brisbane area were stopped between 4:45 and 5:15pm. I myself experienced the havoc this caused as services were wound down leading up to the appointed time. My train was cancelled at 3:23...I had to wait a whole 10 minutes for the next one...unlucky. When I got off at Wilston some guy went and abused the guard in the last carriage. I didn't hear everything but lets just say it started with the passenger offering some choice words...and gestures to the guard...

Here is what occurred...

Passenger: Enraged mutterings and flashing the old "V" sign*
Guard: "We had a Bomb threat you F---ing Moron"

*Some sources claim this gesture came about as a taunt used by the English to enrage the French after the Battle of Agincourt. The French being heartily slaughtered by English Longbows at Agincourt then threatened to cut off the index and middle fingers of any captured Englishmen thus rendering them useless as bowmen. After this the English would present their fingers to the French from across the battlefield, probably shouting something akin to "Come and get them, you silly French Kinigits" I strongly doubt the guard was French so I am somewhat mystified by this.

Now normally the guard offering the explanation of a BOMB THREAT would make even the most foolhardy of irates back down but no. He counters with this...

Passenger: "You can't even run the F---ing trains"
Guard: "Why don't you F---ing walk then..? F---head!"

Anonymous Queensland Rail Guard...I salute you

2. Again some self righteous wanker arcing up at nothing in particular. There I am sitting down at my finest fried potato and grilled pisciform establishment when this prick, y'know one of those metrosexual guys with the giant sunnies and the little mohawks and the blowup blonde girlfriend walks through the tables and chairs set up outside. The owner of the aforementioned establishment is there with his mates having a good old yak. This dude has obviously thought that they've said something to him or about him and snarled at them then stalked off dragging his girl along. Needless to say everyone else present was a little perplexed and wondering why we have to be plagued with the only metrosexual male with tourettes in all of Brisbane.

3. Did my last exam EVER!!!

Dogs Rule.

That is all.

Ninjas are cool

2005-11-12T17:34:00.000+10:00

Go here and you'll see why I've been inspired to write about ninjas. Well that and my brain doesn't work anymore after bombing my Plant Biotech exam. So likelyhood of recieving honours is decreasing daily...hooray!

Anyway on to more important things like...

NINJAS!

A wise man once said that for every ninja you don't see there are 3 more you don't see either...

Which, if you think about it, is a statement that expands exponentially until we are lost in a sea of ninjas...

There's a phrase not uttered enough "Lost in a sea of ninjas..."

anyways

Ninja Strike!

Away!

Gizoogle is the S to the H to the izzle y'all

2005-11-10T18:19:00.000+10:00

Todays pizzost was brought ta you by Gizoogle n shit. It is a mizzost charm'n thing where all yo pimp dreams come tizzle where the sun be shinin and I be rhymin'.

1. You shizzay not worship any gangsta god but Yahweh.

2. You shizzall not makes a graven image.

3. You shall not takes tha nizzle of Yahweh in vain.

4. You shizzall not break tha Sabbath.

5. You shall not dishonor yo parents.

6. You shall not murda.

7. You shall not commit adultery droppin hits

8. You shizzall not steal.

9. You shall not commit perjury n shit.

10. You shizzay not covet.

The textilator makes anyth'n fun motherfucka.

Anyways bizzle ta tha study...

BONUS Shower Gel: Micro Scrub Particles, Desert Minerals + Caring Yucca

2005-11-09T18:16:00.000+10:00

That was pretty much the highlight of my day...

Getting a mini bottle of Lynx shower gel with my purchase of Lynx deodorant.

Lynx: "Micro Scrub Particles"
Subtitle: Little bits of blue crap that could either be finely ground plastic or Smurf flesh

Lynx: "Desert Minerals"
Subtitle: Sand...not special, mystical sand, made from rocks crushed on the thigh of an Arab virgin or anything...just sand...from a pit...

Lynx: "Caring Yucca"
Subtitle: Selfless plants from deserts all over North and Central America gave of themselves to provide us men with the ultimate in personal hygiene experiences.
Sub-Subtitle. We take plant. We juice Plant. We mix them with little blue plastic balls and some sand and/or Smurf flesh.

(For those of you who don't know, Yucca is a spiky North American desert plant and I'm fairly sure it doesn't give two shits about you or your problems. End it now.)

Now that I have satirised the label to my satisfaction I just have this to say...

Is that not the gayest description, of an ostensibly manly and masculine product like Lynx, that you have ever heard?

I mean seriously... We're men! We don't want to be cared for by anything but our mums and maybe later our significant others, least of all our shower gels. No wonder they're giving it away, I mean, you can't even use it as a lubricant...

And since when have we given a rats right testicle about exfoliation?

Having said all of this I'm still gonna use it. Free shower gel is free shower gel. And it smells real purty like.

Omission

2005-11-05T19:55:00.000+10:00

ummm yeah...

Let it be known from hence forth that Jonathan has commented several times and has been a most loyal viewer...

As has EJ...

As has Joe...

Greg also...

So have I...but mostly out loud.

Cheese...Think on it.

The update to end all updates...or maybe not.

2005-11-05T16:00:00.000+10:00

I think its time to get all retrospective on yo' arses.

Lets see in the last 2 months I have...

Gotten a Job

Gained 1 girlfriend

Come 11 days off of finishing off the coursework for my degree

2 of my long standing housemates have moved out

Whats that you say? News to you? well thats ok...

About 2 weeks ago the K's, Hieran and Shieryn, moved out together in to Shieryns brother's place as he's gone to the Land of the Long White Moose, or, Canada.

I have secured an interview with the guy who will supervise me for the Honours I will be doing this summer

So its been a pretty intense 2 months for me what with all the changes, studying for exams and organising honours.

Well thats all the retrospective we have time for today, stay tuned for a continuum of a previous post.

An update on my little rival...

"Danny BEAMO is my
nickname. What kind
of flowers do u like
sweety. Mwah to u 2"

"I think dandelines suit
u. U cant get rid of
them, theyr pretty but
they smell."

"Meh i'm more of a
Coryanthus girl
myself. But whatever
u can afford..."

"Ican afford anythin
including u honey
which orafice do
needs extra attentive"

"Firstly speak english
runt. Secondly stop
it... You're turning me
on"

Now I think what he meant to say was dandelions but I googled what he wrote and got a charming glassware company, linked above, Cory mate if you're reading, something from the 'bustlines' line would be lovely.

Next note how I worked his name into the name of a flower, now don't ask me how I knew there was a flower called Coryanthes (I spelled it wrong in the message) because I have no idea how I knew that.

There was no response to my last message so I might just assume he's given up but just in case he hasn't...

My advice? Get over it. Add her and/or me to your spank bank and move on...

An Ode to Breast

2005-11-03T11:11:00.000+10:00

Ode n. a lyric or poem typically of varied or irregular metrical form and expressing noble feeling [French, from Late Latin (390-700), from Greek: song]

Breast n. Anatomy, Zoology a milk gland, especially of a woman, or of female animals [Old English (before 1100) brēost]

An Ode to Breast

This beauty kept out of sight
So soft and round and warm
So silky smooth, so milky white
So perfect in its form

And yes my dear friend Jon,
They have inspired these rhymes
The young ladies, I happened upon
Who gave me the breast of times

And while I try my best
To describe the great sensation
You yourself must test
And end your fascination

And as to comments a day previous,
I just have this to say
I may have been a mite devious
Keep on to find what way

'Cause from my mouth the words still spilling
'Bout the e'er peak'd dome
If only it had been a womans, willing
And, sadly, not my own

If you are a little confused read Jonathans comment from yesterday...and prolly the actual post as well.

Macho, Macho Man. I Want To Be...

2005-11-02T21:44:00.000+10:00

A Macho Man.

Yes folks one of my secret fantasies came true today. I finally get to be all manly 'n' shit

Received an interesting SMS today, completely out of the blue and an interesting SMS conversation ensued.

Check this out...

"Dan this is about my girl
Alice. I want u to keep
ur greasy hands off
of her. Cory"

"Im watching u Danny
boy Keep the fuk
away from my
girlfriend u little punce
BEAMO"

"Punce eh? I hope
you're happy. That's
twice I've had to
remove my hand from
a breast to answer a
message..."

"More like bitch tits ya
lil fag My lil fuzz is too
good 4 u Cya round
limpwrist"

"Limpwrist? Limpwrist?
Thats the best you
could come up with?
And surely the fact
that i'm going out with
a girl, at least she
was female last i
checked, would
indicate i'm not gay?
Or maybe i am... Cya
cutie pie ;-)"

"Im up 4 anythin honey
buns. No mata what
ya do there will
always b sumthhn"

"Between us. Break
her heart and ill kill
ya. have a nice day at
kindy darlin"

"Awww... How sweet.
Alice has a little rabid
fanboy. Its alright
shnookums she's
safe with me *mwah*"

still awaiting a response to that... (Cory if you're reading this some flowers would be nice)
Someone's movin in on my girl and I get to be all manly and defend my turf...by...blowing them... kisses...

Blowing somone, who is at least 5 years my junior, that I've never met...kisses...

hmmm... my girly sense is tingling...can't quite see why...oh well *shrug*

Normally I would deconstuct this line by line, heaping ridicule and sarcasm as I go, slowly unravelling the poor boys pubescent psyche but...

I'm tired.

And 'twas all in good fun.

Tho I will give this final parting shot...

What is BEAMO?

Be Extra Attentive to My Orifice?

Cory you tease...

Last Assignment Ever!

2005-11-01T21:27:00.000+10:00

Huzzah!

Handed in my last business assignment today.

2716 steaming nuggets of business jargon goodness

15 pages of vegetable enhancing fun

Never again...

Did an all nighter to finish that one off, drank 4 bottles of 'V' in a 16 hour period, thereby approximately quadrupling the RDI and quite possibly turning my liver cirrhotic in the process.

Had 22 references in my reference list, many of which were used more than once, it works out to be a reference every 50 or 60 words...Awesomeness

To address your comment Master Jonathan yes she was involved with biofutures and yes you probably have met her. Give my regards to your brother, he caught me in a bit of a reverie today and I'm sure he thought I didn't recognise him...

Anyways...

Its been a hard days night and I've been working like a dog
Its been a hard days night, I should be sleepin like a log

So I will

Telemarketing is teh sux0r

2005-10-31T12:39:00.000+10:00

ahhhh time for a nice relaxing rant.

The humble telephone. Think on it for a moment...

What a wonder of modern technology it is. Think of all the people who have sacrificed their blood, their sweat, their time, their social life nay their very lives all so we could have a reliable global communication network.

Now consider what it is used for in our modern society, this paragon of modern technology...

Ramming useless shit down our throats in our own homes...

"Hi my name is *insert barely intelligible Hindi word here* and I am ringing to inform you that your number has been selected to recieve a free mobile phone..."

7 times, in the last 14 days, I've heard this.

7 frikkin' times.

And my housemates have recieved it at least twice.

I actually listened to what they had to say the first time. Then, rather politely I thought, I informed the person on the other end that I wasn't interested. She then proceeded to try and convince me to take it, in a tone of voice that told me I was obviously retarded for not. I then, remaining calm, tried to explain that I was already on a 24 month contract with another carrier and that if I did take her phone I would have to still pay the $33 a month I already pay plus whatever calls I made on the new phone.

She remained unconvinced...

God only knows how.

Then when she finally understood she wasn't getting anywhere, I could tell cause I could hear the pout, she got very brusque and hung up on me.

Since then I have recieved more of the same, some claiming to be giving me a free phone before explaining there will be a monthly fee...

So I have 3 pointers for these telemarketing companies before they try and sell me anything...

1. English is the Official language in Australia. Hindi is the Official language in India (plus 17 other national languages). Try to remember that talking over the phone can be hard at the best of times, talking to somone with an accent can make it nigh on impossible. Try and employ well spoken individuals who are fluent in english.

2. Teach your personnel how a plan works. Namely this is a contract signed by me that stipulates that for the period of the contract I will continue to make monthly payments. Should I opt out of the contract before the period of the contract expires I am obliged to pay, in a lump sum, the remaining monthly payments. This means that if your phone costs me anything, anything at all, I. Am. Not. Saving. Money. Even if you tell me three times that I am, I'm not.

Once they understand this they will quickly learn to admit defeat when they hear the phrase "I'm on a plan sorry..."

3. Listen carefully to this one... I. Don't. Buy. Shit. Over. The. Phone. End of story.

So now ya know, and I swear to Vishnu that if I get one more garbled call from some half trained phone monkey offering me a mobile I will call for India to be wiped off the map.

You've been Warned.

Who am I..?

2005-10-28T23:35:00.000+10:00

In the true spirit of procrastination I have found many and varied ways to entertain myself today including...

Sleep

Reading online comics for three hours straight

Taking the Myers-Briggs personality test...

According to the test I am an ENFJ or Extraverted iNtuitive Feeling Judging or, alternatively, an Idealist Teacher.

Apparently this archetype only occurs in 2-3% of the population...I guess that makes me special or something. I've done the test twice now, once last night after my V and chocolate binge and today after I'd had some real food and some sleep. Both times I got the same result so I guess its official now...

Go here and here for a more in depth explanation of my archetype.

Some famous ENFJ's include Oprah Winfrey, John Cusack, Michael Jordan, Johnny Depp, Sean Connery and last but not least...

David, King of Israel...

o_0

This must be a really, really old test...tho you would think it would be called the Habakkuk-Zephaniah test or something

Seriously tho, I suspect they may have gleaned something of his personality from his writings in the Bible

Its 2:51AM...

2005-10-28T02:50:00.000+10:00

Yep its 2:51AM and I'm sitting here in the 24hr Computer Lab here at QUT trying to focus on my assignment. As you can prolly tell I'm not being too successful at the moment...

Added links to Neurotically Yours the home of Foamy, my favourite squirrel, and also to Ruthless Reviews which is funny...'n' shit.

As you can see the lack of the sleeping is slowly bludgeoning my vocabulary to death...'n' shit

I have well and truly exceeded the safe dosage of 'V', by two bottles, which I then washed down with about half a kilo of M&M's, so I'm feelin kinda queasy...'n' shit

Vision blurring...stomach churning...bowels clenching...

not...

much...

time...

*collapse to the floor twitching*

...'n' shit

I wonder if this counts as an altered state of consciousness?

meh...

Will I regret the strangeness in the morning? Look at me getting all Introspective...'n' shit

I AM THE LIZARD QUEEN!

OK Something About Me...

2005-10-27T13:04:00.000+10:00

Well...

Lets See...

Hmmm...

Ummm...

Ooh I know! I got a job!

Wait...No...already posted about that...

I'm nearly finished my degree!

Wait...already posted about that...

I...got...a girlfriend?

Did I Post about that?

No?

Hmmmm well ok...ummm...Her name is Alice (Female. Check!) She is of Dutch ancestry (Human...I'm going to say Check!..tho not Czech just Check.) Her chest rises and falls in a rythmic fashion (Breathing. Check!)

She is graduating from UQ with a degree in Microbiology this year and is hoping to do her honours in the area of Virology and Human Disease. Fingers crossed for her interview with Dr John Aaskov on tuesday :-) go here to learn a little about the Arbovirus program at QUT. She enjoys long walks on the beach, the pathologic basis of disease...and Dance Music. *shudder*

Also she has an inexplicable fascination for cheese bordering on the morbid...

Overall I'd have to say I'm pleased with the situation.

See? Only one link and it was one I went and got myself...

I will try and post more about interesting stuff I do more often

Procrastination...

2005-10-27T10:53:00.000+10:00

Ok first of all does anyone remember the Starbucks joke in Shrek? You know, peasants escape destruction by fleeing from a starbucks, across the road...into another starbucks.

Well apparently its actually pretty common in the real world...

Also I thought this was amusing.

Additionally I have added more links to things that are good...

I hate doing assignments...

Post Posty Post Post...

2005-10-27T10:26:00.000+10:00

Hey all,

Just added a few new links because they amuse me so...

You'll note the addition of the ever entertaining Darwin Awards as well as 4 new comics

I never knew...

2005-10-25T21:52:00.000+10:00

Normally I don't like to post in 30 minute intervals but seriously WTF?

I gotta stop goin to the links people put up on their sites cause this just creeps me out.

Even if you are one of the growing number of people that don't believe that HIV/AIDS exists why risk Gonorrhoea, Chlamydia, Herpes etc.?

And as far as that first article offering a £1000 for proof that HIV exists...go talk to a gene therapist, its being used as a vector...

for those non-biotech people out there that means that they are using HIV as the delivery vehicle for inserting genetic material in an effort to fix genetic diseases...

Jaw Dropper...

2005-10-25T20:44:00.000+10:00

Seriously this just kicks my arse...

Every time I go back to it I am shocked and awed.

My brain turns to goo. My hands feel like arthritic claws. My guitar mysteriously tries to escape when it is reminded it will NEVER be played like this...hard and fast, just the way it likes it...

Even if you is not into the guitar at all...

Seriously have a play with the mapped keys in the lesson section.

Now if only he could write a song...

Oh. My. God.

2005-10-20T13:45:00.000+10:00

Ok now before you go to the link I am about to provide...

I MUST WARN YOU!

If you are easily offended or hell even if you are not easily offended tread carefully with this link...

WTF?

o_0

Seriously WTF? Is it a joke? Is he serious?

Anyways I'd just like to say that I found that site through this webcomic...I didn't know what I was in for...and frankly I think there should have been some kind of warning attached...

I need new material...

2005-10-20T10:12:00.000+10:00

Apparently the fax that was supposedly sent to the Seattle PD's Chief was in fact sent to everybody but the Chief.

In other news, had the last LS50 (LS50 is the course code for my degree) meeting ever yesterday.

Very sad :-(

On the bright side I did manage to steal almost 2 pizzas from the feast that was provided for us.

On the down side I prolly wont see most of the people I know from my course, outside of exams and the post exam party, again...

So 'tis the end of an era...

I'm gonna try and hand in my honours project by December 12 and then I Graduate in February or March...

Then it's on to another honours course, this one taking a year and then I'll have 2 degrees both with honours.

The Saga Continues...

2005-10-19T10:34:00.000+10:00

Yep Wacko Jacko (the non kiddie molesting one...so far as we know) has taken things up a notch

Head on over to here to see a copy of the fax he sent to the Seattle Police Department calling for the arrest of Tycho and Gabe.

Did anyone else notice he got the URL for the Penny Arcade site wrong?

He claims that they have started a harrassment campaign against him.

Everyone else seems to think he sent the letter because of this...

Incidentally this is not the first time he has tried to have the operators of a gaming related site arrested head on over to here to see a humourous rundown of that story...

Anyways have fun...

Ok this is gonna take a while...

2005-10-18T12:30:00.000+10:00

Ok kiddles I just thought this was awesome and highly entertaining so I'm gonna try and share the whole story here.

Firstly there is this man named Jack Thompson...I know some of you may be thinking of the veteran Australian actor of the same name but the Aussie Jack is like a billion times more cool than this guy. that should give you enough background to go on with but don read the whole thing.

Next as some more background there is this kick arse little discussion between a supposed 14yr old kid and Jack.

What a little trooper if he is 14.

Then came Jack's little spat with Mr. Ramsoomair over at VG cats

Then Jack made a proposal to the gaming industry

Tycho and Gabe over at Penny Arcade! got in on the act after Jacks proposal came out. (look for Jack Thompson and Jack headlines)

A response followed from Jack...

Ably ridiculed by PennyArcade!

Followed by several events...

1) the Founder of The National Institute on Media and the Family releases an open letter telling Jack to back off...

2) Several groups of modders get together and release a couple of mods of GTA: San Andreas that answer Jack's challenge. (I would link to one but their site appears to be down)

3) Jack refuses to cough up the money he had offered because he says his statements were "satirical"

4) Tycho and Gabe give $10,000 in the name of Jack Thompson to the charity they feel the recipient to be, Paul Eibeler, would have chosen, the Entertainment Software Association Foundation...

5) Jack threatens them with legal action for defaming him...

In summing up...

Jack Thompson...

What a Tool...

Creamy Bacon Carbonara

2005-10-16T18:17:00.000+10:00

Just added a link to NewScientist.com over in the cool links section.

So yeah check this out...

In other news the intense heat of my microvaeable pasta meal appears to have melded the bottom of the ice cream container I made it in with the varnish on top of my desk...

Getting a wonderful chemical aroma wafting up as I eat...should prolly stop eating near it...

Meh...can't be bothered

I want to be the Vice President of the USA...

2005-10-15T16:46:00.000+10:00

I want to be the VP of the USA

check this out.

Holy god what an Arse...

This is so frickin' cool...

2005-10-07T21:05:00.000+10:00

Head on over to here and check out the red blood cell that's been fitted with an artificial tail.

My thanks must go to Greg for drawing this to my attention.

On another note 2 more weeks of lectures...ever!

Soooo good. Exams will be over a month after that and then it's on to my double honours...

I've figured out that by the end of 2009, if all goes to plan, I will be...

*deep breath*

Dr Dan Nathan Levi Abrahmsen B. BiotechInnov (Hons), B. AppSc (Hons) PhD

I can't wait for my business cards...

Epic...

2005-10-06T22:31:00.000+10:00

yo...

this may in fact be the greatest movie ever made...I shit you not.

I almost cried when i read this

Fan Poll...

2005-10-04T21:29:00.000+10:00

Just out of curiosity which one of these best represents me as a south park character?

yes thats right you can have your say by voting now!

Yo...

2005-10-04T19:20:00.000+10:00

I know i promised photos of the party but seeing as i had included 15 photos in the post i was doing up yesterday before blogger was down for maintenance and i lost the post i don't really feel like doing another one. Suffice it to say a good time was had by all...

Except the ladies who were ogled...

and not in a good way...

I'm out...

Ahhhh the hilarity....

2005-10-02T12:16:00.000+10:00

Hey kiddles...

You have to check this out and when you is done check this one out. Ahhh... i have to admit i was forced to laugh out loud or 'LOL' in the common vernacular by these pages. I consider myself somewhat of a metal fan but that stuff is retarded. Its like some extremely repressed angsty kids got together and tried to figure out what would freak people out the most...then got it wrong.

on another note, last night during Lyss' party, i found a cd that i had imported from the netherlands and that i thought i had lost...so yay!

on the party side of things there should be photos forthcoming...

Apology

2005-09-29T18:56:00.000+10:00

Sorry to everyone who might wish to comment on my blog...ever

You will now have an additional step when you want to comment in the form of a word verification this spam comment thing sucks the balls so i gots to filter it.

Disclaimer

2005-09-29T18:49:00.000+10:00

hey

just wanted to point out that my previous post was NOT a serious request

sorry to disappoint.

I know i have just shattered the dreams of a horde of screaming women but this is the way it has to be.

also if the comment directing me to an online dating site was spam then Fuck Off

If it was genuine then thanks for the thought but no thanks.

The only reason i said what i did is because most people who know me will have heard me proclaim that women are too expensive. I mean you've gotta take them places and buy them things and at $200 an hour i just can't afford that

p.s. i get paid $24.34 an hour to sit on my arse...best job ever

It is time...

2005-09-23T20:05:00.000+10:00

I gots a job. $20 an hour doing data entry for the Office of Commercial Services at QUT. Should be slightly less stimulating than watching paint dry.

Well seeing as I now have gainful employment, for the next few months at least, I have decided that I can now afford a girlfriend. So ladies if you would like to go out with a funny, intelligent, reasonably good looking guy like myself with a big future in data entry ahead of them then this is what I'm looking for...

1. Breathing

2. Human

3. Female

Thankyou

Dan

I live!

2005-09-10T11:18:00.000+10:00

yep...still alive

not that any of you noticed the fact that i hadn't posted in a while

Went to a Biotech/Pharma careers night a coupla days ago. helped set up then spent most of it waiting outside for a guest that was coming late.

Then there was the free alcohol and food. Bonus!

My Head of Department for Science from high school was there. Turns out he's now in charge of Science for education Queensland. He remembered me which was cool, still creepy he was there tho...

we went out afterwards cause the free alcohol dried up pretty quick and these photos are the results...

This is Chris Collet our course co-ordinator, EJ and Brett. Chris came out to the pub with us, how cool is that? Rock!

I was complaining about how painful EJ's flash was so she took another photo...I may also have been mildly intoxicated

This is Bec, Lyss and Kez. The 2 ladies on the right are my housemates and that figure on the far right may or may not be the Dark Lord, Satan himself...or it could just be Nathan a guy who graduated from our course a coupla years ago...I'll let you decide...

This is Bec. She is quirky, mildly evil and very, very obsessed with fire. Good combination.

So yeah it was a good night...

I'm back

2005-08-29T11:39:00.000+10:00

Hey all,

its been a while but I've been muy busy with uni and the whatnot. Had a family luncheon thingy at which i was awarded cash and prizes to the value of $240. Thanks family you rock!

There's a hole in the arse of my pants about the size of a 20c piece at the moment. For anyone that knows me you'll be aware that I only posess one functioning pair of pants so this is a sad occasion indeed. Looks like family money will be spent on pants.

Only 7 weeks to go and my degree is finished. Its kinda creepy. I might actually have to get a job soon *gasp*

My new favourite saying is "Colder than a penguins third nipple" Hoping to use it in conversation before the week is out.

I made a comment in one of my previous posts about how normally placid animals have a thing for attacking or urinating on me. Remind me to explain that by reliving traumatic childhood experiences in a future post.

Nothing much to report...

2005-08-23T16:33:00.000+10:00

Yeah haven't updated in a while so here's whats been happening...

...

...

...

...I knew there was a reason I hadn't been updating...

Bottom fiendoo where are are yooou?

God Bless Libra

2005-08-17T10:19:00.000+10:00

The word Lethologica describes the state of not being able to remember the word you want.

Got that off a panty liner...

mmm soooo soft and absorbent...and sticky on one side which is disturbing.

Yes it was an unused one thank you very much. You sickos...

Teleology

2005-08-16T13:34:00.000+10:00

There you are your word for the day

Teleology n. The study of evidence for the idea of design or purpose in nature.

So you could say if you were of a certain persuasion that "All christians are teleologists as they seek to impose on nature a design or purpose through the idea of a divine will"

Thats the best example I could come up with...

Use it on someone who thinks they is smart and confuse the shit out of them.

Arsetard refers to one who is stupid, imbecilic, asinine, docile or vapid as opposed to an astard (Bastard without a B) someone who was born out of wedlock or who is just being a prick.

I also envisage the word being used in politer company where the word Fucktard would be unacceptable.

Oh...

...and death to America.

From the fevered mind of me...

2005-08-15T16:12:00.001+10:00

I have created a new word... Arsetard

'Tis an unholy combination of Arsehole and Retard, their bastard child if you will

Go forth my children and use it at will

Some possible uses of Arsetard:

"You, sir, are an Arsetard."

"Arsetard!" an exclamation of surprise or alarm, from the back of the throat...

I need sleep.

WHEN IN DOUBT SEND MONEY!

2005-08-15T16:12:00.000+10:00

Not much interesting happening. Had dinner with my aunt the other night. Found out that she had considered shouting me a trip to a brothel for my birthday. Not sure how to take that...

I spose one consolation is she thinks I'm straight. Which is good cause a couple of times there my other aunt may have been trying to suggest that she thought I was gay...

Which I'm not...

*cough* Manly!

Hey ladies...*wink*...how you doin?

I miss you bottom fiend...

Don't worry...found it...

2005-08-10T23:38:00.000+10:00

Yeah its ok everyone can stop looking.

go here for a little description.

turns out it's two camel spiders...

Its still creepy...

I wish I knew

2005-08-10T22:49:00.000+10:00

Can anybody tell me what in the hell this is?

I count 8 pairs of legs at least.

It could be 2 of whatever it is.

Creepy...

A response...

2005-08-08T11:14:00.000+10:00

Yes i do believe in freedom of speech...

As long as it is not derogatory or defamatory to anyone.

Professor Fraser's comments, and I will admit i have been unable to find an original copy of his letter, as far as i can tell, were sweeping generalisations without any evidence. I am not satisfied with having to rely on quotes from the letter as i understand that certain sentences can be taken out of context but from what i can see his claims that letting in black african immigrants will lead to higher crime rates due to their below average IQ were made without providing any reference to a source, reliable or otherwise, for this information.

Fraser, as an academic, should know better.

Just discovered an article that mentions that he referenced a psychology journal where some researchers made a link between heredity and IQ. Incidentally there was a contradictory article in the same issue...

I can't get over his audacity at claiming that non white people could never call themselves Australians like the Anglo-celtic first settlers. Does he discount the indigenous population that has been here, even at conservative estimates, 100x longer than europeans? Most of the things he claims are down to race are due to social and other environmental factors, such as socio-economic status, level of education etc. NOT race. Should we be turning away the Irish because we don't want to invite Catholic-protestant violence into our community?

In summing up this is not freedom of speech this is a man putting forward a personal issue using his "authority" as an academic to validate his words.

Rant over.

OMFG!

2005-08-07T21:48:00.000+10:00

Caffeinated Soap!

I shit you not.

Cleft?

2005-08-07T18:24:00.000+10:00

Just finished watching the second season of The Coupling last night. Strongly recommend you watch all of them if you get a chance.

Then the title of this post will make sense and result in riotous laughter.

Learnt a new word from Absolutely Fabulous. Flapsnot

A definition of which can be found here.

Warning! not for the squeamish or easily offended...Remember it's ME telling you this. Mr. Inappropriate. Remember the cow story?

Its now my life's ambition to use the terms "flapsnot" and "snerk" in a sentence...

"Hehe I said flapsnot..." *snerk*

Well thats good i can spend the rest of my life in bed now.

In other news tried to teach myself some Hendrix...didn't work.

Got the start of Purple Haze tho. Rock! \m/

Am listening to TOOL at the moment. Have decided i want to start learning the drums.

*scrabbling for something interesting to write about*

ooh ooh i know went to the UQ (University of Queensland) open day today. Found out I have virtually no interest in doing physiotherapy, audiology, occupational therapy or speech pathology post grad.

which is good. narrows it down a bit.

Oh and i think that Professor Andrew Fraser should be deported for this

I might do a rant about him tomorrow. Oh yeah and i think the cow story should be published too.

The blue thing is a troll...

2005-08-06T16:28:00.000+10:00

yeah i just thought this was funny...

a more loquacious blog will be forthcoming...as soon as something happens...

Improved this movie it has...

2005-08-05T00:15:00.000+10:00

All you Star Wars fans go here for much hilarity. All you non Star Wars fans go here

...also for much hilarity.

Caution: Bowl and soup may be hot to handle.

2005-08-04T20:13:00.000+10:00

It was on the can of soup i had for dinner...

Mistress Fiend as i will refer to you from now on...

If you don't translate my message you'll never know what i asked :(

Its ok you answered my question with an affirmative anyway.

I'm fairly certain you are part of the 'biotech crew'and now i know you have a thing for making up words.

I'm going to have to assume that at some stage you will reveal yourself to me as it seems that asking you wasn't enough...

So pathetic but its late...

2005-08-03T22:35:00.000+10:00

agggattcgg gcctgggact gtgtctgtcg cccatggccg ccgcgctgct cgcccgggcc tcgggccctg cccgcagagc tctctgtcct agggcctggc ggcagttaca caccatctac cagtctgtgg aactgcccga gacacaccag atgttgctcc agacatgccg ggactttgcc gagaaggagt tgtttcccat tgcagcccag gtggataagg aacatctctt cccagcggct caggtgaaga agatgggcgg gcttgggctt ctggccatgg acgtgcccga ggagcttggc ggtgctggcc tcgattacct ggcctatgtg gattcttctc atcggtgaaa ctgctcatat aaataccgcg ggagccatca actttattga aaacgattag acgccatcgc catggaggag atcagccgtg gctgcgcctc caccggagtc atcatgagtg tcaacaactc tctctacctg gggcccatct tgaagtttgg ctccaaggag cagaagcagg cgtgggtcac gcctttcacc agtggtgaca aaattggctg ctttgccctc agcgaaccag ggaacggcag tgatgcagga gctgcgtcca ccaccgcccg ggccgagggc gactcatggg ttctgaatgg aaccaaagcc tggatcacca atgcctggga ggcttcggct gccgtggtct ttgccagcac ggacagagcc ctgcaaaaca agggcatcag tgccttcctg gtccccatgc caacgcctgg gctcacgttg gggaagaaag aagacaagct gggcatccgg ggctcatcca cggccaacct catctttgag gactgtcgca tccccaagga cagcatcctg ggggagccag ggatgggctt caagatagcc atgcaaaccc tggacatggg ccgcatcggc atcgcctccc aggccctggg cattgcccag accgccctcg attgtg

Muhahaha! find my message if you can...

I should be at uni...

2005-08-03T10:21:00.000+10:00

Eating porridge while listening to Hendrix is fun :)

More fun than it should be...

Ooh wait...

...dun dun doo, du-dun dun doo, du-dun doo...Foxy!

...dun dun doo, du-dun dun doo, du-dun doo...Foxy!

...I'm back, sorry Foxy Lady cannot be ignored. Must dance. And yes I am in my underwear and if my male housemate were here he would be in his underwear too and we would be having pillowfights because the girls are out...

So...

Bottom Fiend...you like...

...stuff?

I think the porridge has clogged my brain. It not work properly.

Putting the word out on the streets...Braaaaains...

2005-08-01T19:49:00.000+10:00

Hey folks Joe has just had a brainwave...mmm Braaaains...

Joe: We need a zombie weekend

Dan: How exactly would this operate?

Joe: Some of us would dress like zombies and eat nothing but brain like stuff...and we'd go out in public and be all "RRRR"

Dan: Totally and we could watch all of Romero's films

Joe: YEAH! Rock!

Joe: Blog it you fuck

so in summing up we should have a zombie weekend possibly culminating in a viewing of Land of the Dead or whatever it is thats coming out soon by George A. Romero.

What do we think children? Zombie good? or Zombie baaaad?

The story becomes ever more viscous...

2005-08-01T09:25:00.000+10:00

How to respond, how to respond...

First off some clues about our interloper (assuming there is one). Firstly they chose to write their message using an RNA sequence. The difference between DNA and RNA is that DNA uses the four bases Adenine, Cytosine, Guanine and Thymine while RNA uses Uracil instead of Thymine. This may mean something as it takes effort to do this. Most codon encoders use DNA as the bases of choice. Secondly they were thoughtful enough to put a stop codon in at the end. A stop codon tells the ribosome (the thing that makes proteins using the code supplied from mRNA) to stop producing protein, that it is finished. Thirdly the most common form of RNA in a cell is mRNA or messenger RNA. The DNA in the cell nucleus gets copied into mRNA and then the mRNA makes its way out of the nucleus and finds a ribosome where it is translated into protein. The significance of this is that they were writing me a message using messenger RNA.

Oh so geeky.

I love it.

Not that I'm encouraging "The Interloper"

...'cause y'know lame and all that...

anyways after that happy little molecular biology lesson on to Bottom Fiend his or herself (i'm leaning towards female). In your happy little ditty you wrote that you have only posted twice well i count three not inlcuding last nights. Are you only counting from your first verses onwards? is this a mistake? are you toying with me? (i knew it was female) or maybe your poetic skills were not up to including the number three (you could have used thrice) Anyways i will post a message in reply when i get the time that will separate the Biotechnologists from the Journalism majors...

i.e. those that actually do biotech (most of my friends) from those that can just research well (the rest of my friends)

The plot thickens...

2005-07-31T19:48:00.000+10:00

I am reprinting the comment from one bottom fiend here as it's not showing up down below anymore.

GACGCUAACAUGGCUACCGAG
ACUCAUAUAUCGAUUAGCGCAAAUGAAUGGCACAUCAACACC.......
CCCGAGCGCCACGCUCCCAGU???
GCUGCUGCUCAUGCUCAUGCUCAUGCUCAUGCUCAUUAA!!!!

Now for those of you who are a bit confused this is a message written using the genetic code. Each letter represents a base in a sequence of DNA. DNA usually codes for a protein (a protein being composed of chains of amino acids that fold into very specific shapes based on their sequence) so to make it easier for us scientists each one of the 20 amino acids that could be used to form a protein have been assigned a letter. Each codon of DNA (a codon = 3 bases of DNA) therefore represents an amino acid because that is the minimum length of sequence needed to make sure there are 20 unique codons at least. So in this case, upon translation the first sentence reads:

gacgctaacatggctaccgagactcatatatcgattagcgcaaatgaatggcacatcaacacc
D  A  N  M  A  T  E  T  H  I  S  I  S  A  N  E  W  H  I  N  T

The second and third:

cccgagcgccacgctcccagt
P  E  R  H  A  P  S

gctgctgctcatgctcatgctcatgctcatgctcattaa
A  A  A  H  A  H  A  H  A  H  A  H  *

I suspect there is a typo in the last sentence but hey its still pretty obvious.
There will be a reply. Oh mercy yes there will be a reply.

Once i've recovered from last night.

I'LL NEVER TELL

2005-07-30T12:25:00.000+10:00

Yes folks its a little tricky
One of those things you know?
Understanding it took alcohol

And some sleep
Right now i feel kinda stoopid
Especially cause i had it pointed out to me

Amusing though isn't it?

So its out now
Maybe one day they will tell
Apparently I probably did talk to them
Really good acting on their part
Telling me Lies
And now i have to hunt them down and kill them
Rhyming is too much effort
So i'll just write these strange sentences
Expecting them to get the message

:)

WTF?

2005-07-30T09:54:00.000+10:00

If its not Monsieur Robson then it must be princess consueila banana-hammock-kiedis-carter-flowers-grohl-jameson-armstrong-depp. Now i see why you english in major and i don't.

(yes that was intentional)

I thought it was a female but then i ran out of female friends CAPABLE OF GIVING ME A DRINK. So then i thought it must be male and Master Robson was the obvious choice due to his penchant for poetry.

If its not princess consueila banana-hammock-kiedis-carter-flowers-grohl-jameson-armstrong-depp then it could be Joe in which case you owe me a drink at tonights 21st

In summing up I want my drink

A conundrum...

2005-07-29T21:35:00.000+10:00

Do you have a thing for bottoms Mr. Robson, my oh so poetic stalker?... that took some effort with the rhyming and whatnot. Well done.

if anyone else is confused by the above sentences read the comment in the post below...

meh too tired. will try and be funny tomorrow.

I'm so glad he's been discharged...

2005-07-28T23:40:00.000+10:00

I've just been checking out a very old friends site on deviantart.com located here or over to the right in the friends section and have discovered an extremely funny list of things he shouldn't do. Keep in mind that he enlisted in the RAAF (Royal Australian Air Force) as a signals operator. He had one of those jobs where he could tell you what he did but he'd be forced to kill you afterwards. Anyway check out the list and thank god he's no longer responsible for any part of the defence of our country...

Edit: I think i should point out that, knowing Joe, he's not making any of these things up.

I swear my computer is female

2005-07-28T10:55:00.000+10:00

Yay! she's talking to me again!

Yes folks the network cable has mysteriously replugged itself and so i have the internet again. I swear this computer is female. It's moody, sometimes completely shutting itself off from me for no reason, about once a month everything goes to hell and i just have to leave it alone for a few days and its always going down on me...

Had an interesting day yesterday, went to uni on about 4 hours sleep, can't remember a whole lot of the day. I was a good boy and had gone to bed at 11 the night before but didn't get to sleep til after 3:30am. Stoopid brain. Anyways my aunt rang at like 7:30 this morning so i'm functioning on 10 hours sleep for the last 2 days. Which means I'm not functioning...in fact...I'm goin back to bed. Good Morning.

Let the feminists come...